| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.073069 |
| Chromosome: | chromosome 3 |
| Location: | 5185233 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g181350 | bL17m,MRPL17 | Mitochondrial ribosomal protein L17; (1 of 2) K02879 - large subunit ribosomal protein L17 (RP-L17, MRPL17, rplQ) | 3'UTR |
| Cre03.g181400 | ADC1 | Aminodeoxychorismate synthase; (1 of 1) 2.6.1.85 - Aminodeoxychorismate synthase / ADC synthase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGAATGTTGGAGCCTCACACTATCTGTATCAACTGCTTACTGCTGCAG |
| Internal bar code: | TTTAGAGCGATTCTTGCCTGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1205 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 36 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGGCTTGATGCTCAGCCTT |
| Suggested primer 2: | CTAACGCAATGCTGGGATGC |