| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.073072 |
| Chromosome: | chromosome 16 |
| Location: | 6707410 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g673150 | HDA14 | (1 of 1) PTHR10625:SF124 - HISTONE DEACETYLASE 9; RPD3/HDA1 type histone deacetylase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATGAGGGGGGCGGTGGTTGGGGTGCTCGAGCTGCTGCGCTACTGCGGCA |
| Internal bar code: | TTTCTGTCGGTTTTGCTAATGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 165 |
| LEAP-Seq percent confirming: | 7.69231 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 36 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TATTTCGGGCAGAACCACCC |
| Suggested primer 2: | ACTCTGCGACAACCTCAGTG |