Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.073072 |
Chromosome: | chromosome 16 |
Location: | 6707410 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g673150 | HDA14 | (1 of 1) PTHR10625:SF124 - HISTONE DEACETYLASE 9; RPD3/HDA1 type histone deacetylase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATGAGGGGGGCGGTGGTTGGGGTGCTCGAGCTGCTGCGCTACTGCGGCA |
Internal bar code: | TTTCTGTCGGTTTTGCTAATGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 165 |
LEAP-Seq percent confirming: | 7.69231 |
LEAP-Seq n confirming: | 3 |
LEAP-Seq n nonconfirming: | 36 |
LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TATTTCGGGCAGAACCACCC |
Suggested primer 2: | ACTCTGCGACAACCTCAGTG |