Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.073089 |
Chromosome: | chromosome 6 |
Location: | 1718071 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g262700 | QCR7 | (1 of 1) K00417 - ubiquinol-cytochrome c reductase subunit 7 (QCR7, UQCRB); Ubiquinol:cytochrome c oxidoreductase 14 kDa subunit, mitochondrial | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATCGGAACCGCTCATGGCGCGCCAAGCAGCGTGGCCACGTTTGTGAGGA |
Internal bar code: | CGATTTTCCGTGCTATTGAACA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2340 |
LEAP-Seq percent confirming: | 67.2414 |
LEAP-Seq n confirming: | 39 |
LEAP-Seq n nonconfirming: | 19 |
LEAP-Seq n unique pos: | 58 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAAGCTGTGCGGCCCTATAT |
Suggested primer 2: | AGCTGTTGATTGAGGAGGCC |