Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.073137 |
Chromosome: | chromosome 8 |
Location: | 4447503 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g385650 | (1 of 4) K02206 - cyclin-dependent kinase 2 (CDK2) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGAACAGCGGCCATCTGTTGCTGACTTCAAGCACGCAGCAGGCGGCGCT |
Internal bar code: | CGATGTCGCCATGGAAGGGCTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 436 |
LEAP-Seq percent confirming: | 75.0 |
LEAP-Seq n confirming: | 9 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGGCAGATGAGTCACACCA |
Suggested primer 2: | CCAGGATGCACTAGCCTACG |