| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.073142 |
| Chromosome: | chromosome 16 |
| Location: | 3931105 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g689300 | STPK24,PTK27,STK24 | Serine/Threonine protein kinase; (1 of 10) PTHR23257//PTHR23257:SF520 - SERINE-THREONINE PROTEIN KINASE // IP11267P | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTTGCACCAGCGCGCCTAGGAGGCCTCAGCGCAAACCCTCCTCTCGACT |
| Internal bar code: | CTGTATCATAAAGGCACCTCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1086 |
| LEAP-Seq percent confirming: | 95.4545 |
| LEAP-Seq n confirming: | 21 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGTCAGTAATCTGCTTGCG |
| Suggested primer 2: | GACTGAGCCCCTCTGGTCTA |