| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.073156 |
| Chromosome: | chromosome 17 |
| Location: | 4269206 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g729800 | ALB3B | ALBINO3-like translocon protein; (1 of 3) K03217 - YidC/Oxa1 family membrane protein insertase (yidC, spoIIIJ, OXA1) | 3'UTR |
| Cre17.g729850 | PF6-IP4,C1a-18,FAP227 | Flagellar central pair-Associated Protein 227; (1 of 5) 2.7.1.68 - 1-phosphatidylinositol-4-phosphate 5-kinase / Type I PIP kinase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAAACATATACGTAGCCACTTTTGCATAAGGCTTGCAGCGCGCTCGGCAA |
| Internal bar code: | GCCATGAAATCATACCAATTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 713 |
| LEAP-Seq percent confirming: | 11.1111 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGAGGTGGAGGTGGTATCCT |
| Suggested primer 2: | CCATGGTGGCATGTTTGGTG |