| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.073181 |
| Chromosome: | chromosome 6 |
| Location: | 6443893 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g293700 | MRPL7,L12 | Ribosomal protein L7/L12 family protein; (1 of 1) K02935 - large subunit ribosomal protein L7/L12 (RP-L7, MRPL12, rplL) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACCTGTATTAGATTGGCTCAACTGGCGTCCACAGCAGTCACCAGTGCC |
| Internal bar code: | TGTACTGTACATAGGTACTACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 204 |
| LEAP-Seq percent confirming: | 1.72414 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 57 |
| LEAP-Seq n unique pos: | 58 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGACGGTGAGAACAGTGTGA |
| Suggested primer 2: | CCACGCTGGAACCTGTTTTG |