| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.073183 |
| Chromosome: | plastome |
| Location: | 5010 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802264 | petD,ChreCp002,2717021 | cytochrome b6/f complex subunit 4; (1 of 1) K02637 - cytochrome b6-f complex subunit 4 (petD) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACATGTTCCCTGTTGTTATTTTAGGTACATTTGCATGTGTTATTGGTTTA |
| Internal bar code: | TACTAAAGCGGTTAGGCCTATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 93 |
| LEAP-Seq percent confirming: | 9.30233 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 39 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGAGTGGCTGAAAGTGACC |
| Suggested primer 2: | CCCCTTCGGGCAAGTAAACT |