Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.073191 |
Chromosome: | chromosome 17 |
Location: | 6388353 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g802145 | (1 of 8) PTHR23023:SF130 - INDOLE-3-PYRUVATE MONOOXYGENASE YUCCA1-RELATED | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATACATACATACACACACGCCTATTCTCTCAGCACCCACCACCCACCTGC |
Internal bar code: | CGTCACGTTGGATCCGCCAATA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 499 |
LEAP-Seq percent confirming: | 50.0 |
LEAP-Seq n confirming: | 7 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTTTACCCCTCACCCCTTC |
Suggested primer 2: | TACTGCTGCTACTGCTACGC |