Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.073219 |
Chromosome: | chromosome 9 |
Location: | 3312901 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g395288 | NHA1 | (1 of 1) PTHR10283:SF103 - GENOMIC DNA, CHROMOSOME 3, P1 CLONE: MLD14-RELATED; Sodium ion/proton transporter protein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACACACACGCACACACACACTCATGTATACACGCACACACGTTGCTGTA |
Internal bar code: | AGTACTCGCCTCGAGCCCGAGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 615 |
LEAP-Seq percent confirming: | 82.6087 |
LEAP-Seq n confirming: | 19 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACTGCCTTGCTCCAGATCAC |
Suggested primer 2: | AGAGGGGACAATCCAAAGCG |