Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.073232 |
Chromosome: | chromosome 17 |
Location: | 526948 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g699350 | SMM51 | (1 of 13) PF12847 - Methyltransferase domain (Methyltransf_18); S-adenosyl-L-methionine-dependent methyltransferase | 3'UTR |
Cre17.g699400 | (1 of 6) PTHR10994//PTHR10994:SF72 - RETICULON // SUBFAMILY NOT NAMED | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAATATGAATAAGGATGTCATGTGATTCCCTGCGTCTCATCGTGCTGGCG |
Internal bar code: | ATAGTTGACATGACCGCTAGAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1873 |
LEAP-Seq percent confirming: | 25.2632 |
LEAP-Seq n confirming: | 24 |
LEAP-Seq n nonconfirming: | 71 |
LEAP-Seq n unique pos: | 95 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTTGGCGTAAGGGTGAGGAA |
Suggested primer 2: | CCTTGGTACTGCCTAGCTGG |