Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.073238 |
Chromosome: | chromosome 9 |
Location: | 2117875 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g396050 | (1 of 5) PF04884 - Vitamin B6 photo-protection and homoeostasis (DUF647) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCGTAAGGACCGGCCAAAACGCGCACCCAATCACCAGGCTGCGACTGCC |
Internal bar code: | CGCCGTAGGGTCAGTGGAGCAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 864 |
LEAP-Seq percent confirming: | 47.1698 |
LEAP-Seq n confirming: | 25 |
LEAP-Seq n nonconfirming: | 28 |
LEAP-Seq n unique pos: | 53 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCCACGTACTGTACACACG |
Suggested primer 2: | CCAGAGCCCCAAAATGCCTA |