| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.073246 |
| Chromosome: | chromosome 9 |
| Location: | 4950563 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g801063 | (1 of 5) IPR025476//IPR027417 - Helitron helicase-like domain // P-loop containing nucleoside triphosphate hydrolase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTCTGGGGTCATCGGAACAACTTGTCCACAATTCCGAAACTGCAGCTTC |
| Internal bar code: | CCGCTCCTGTTGACATGAAATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3146 |
| LEAP-Seq percent confirming: | 75.0 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAGTCGGAACAGAGTGTGC |
| Suggested primer 2: | CGTGCGTTGGATTGTTGTGT |