Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.073251 |
Chromosome: | chromosome 10 |
Location: | 3066501 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g441100 | PIGT,GPIT1,GPI16,GIT1,PIGT1 | GPI transamidase component Gpi16; (1 of 1) K05292 - phosphatidylinositol glycan, class T (PIGT) | 5'UTR |
Cre10.g441150 | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGAGGCTCTTTGACCCTCCGCGCGCGATTCATGGAACTGCAATACGTC |
Internal bar code: | TGGTCGTCGATGCGTTAAGCCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 5381 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 112 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 112 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCGGCCAGGGATTTTAATG |
Suggested primer 2: | TTTCTCACAGTCACGGACGG |