| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.073292 |
| Chromosome: | chromosome 12 |
| Location: | 6542268 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g538100 | GST9 | Glutathione S-transferase; (1 of 3) K07393 - putative glutathione S-transferase (ECM4) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACCCAGGAACAACAATAGGGGGGGGGGGGCAAGCGGACAGTTGATGGGG |
| Internal bar code: | ATGAATGGACGGAAGAGTTCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 497 |
| LEAP-Seq percent confirming: | 34.8837 |
| LEAP-Seq n confirming: | 30 |
| LEAP-Seq n nonconfirming: | 56 |
| LEAP-Seq n unique pos: | 86 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCCCCTCATTCACCCAACC |
| Suggested primer 2: | GCATGTATGTGCAGGCATGG |