| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.073331 |
| Chromosome: | plastome |
| Location: | 19180 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802270 | petB,ChreCp008,2717017 | cytochrome b6; (1 of 1) K02635 - cytochrome b6 (petB) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATGCGAAAGCTTCTGCTACTGTTGGACGGTAGTAGAAAGTCATAGCAAA |
| Internal bar code: | TGGTTCATCATTATAGGAAGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 231 |
| LEAP-Seq percent confirming: | 56.7568 |
| LEAP-Seq n confirming: | 21 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCCTTCGGGCAACTAAAGT |
| Suggested primer 2: | GCTTGACCAACACCAACACC |