| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.073339 |
| Chromosome: | chromosome 2 |
| Location: | 8437946 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g142352 | TSH1 | (1 of 1) PTHR11476:SF7 - HISTIDYL-TRNA SYNTHETASE, ISOFORM D; Putative histidinyl-tRNA synthetase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCAGCGCCTCCACCGACAGCGCCGCCGCCGCAGTGGCCGCGCTCAGCAG |
| Internal bar code: | ATAGATCACATATCGAACTTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 194 |
| LEAP-Seq percent confirming: | 1.75439 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 56 |
| LEAP-Seq n unique pos: | 57 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGAGCGCATCAAGAAGGAGT |
| Suggested primer 2: | CCCCTATGGCTTGCCAAGAA |