| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.073352 |
| Chromosome: | chromosome 7 |
| Location: | 237854 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g313700 | TSX2,GTS2,TSE2,GTS2:GLTX | Glutamyl/glutaminyl-tRNA synthetase; (1 of 2) 6.1.1.17 - Glutamate--tRNA ligase / Glutamyl-tRNA synthetase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCTGACTCTCGATCCCTGCCCCTCACCGGTAGATGGGCGGCAGCTTCT |
| Internal bar code: | GGCTGCGCCGACACTCGTCTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 176 |
| LEAP-Seq percent confirming: | 18.1818 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTCCCTCCAGACGTACTCA |
| Suggested primer 2: | GTCATCCCTCCCTCCCTCTT |