| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.073361 |
| Chromosome: | chromosome 16 |
| Location: | 5550955 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g681800 | IPK | (1 of 3) 2.7.1.159 - Inositol-1,3,4-trisphosphate 5/6-kinase / IP56K; Inositol 1%252C3%252C4-trisphosphate 5/6-kinase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGCAGGCGGCGCGCACTGCAAAAGTCCGCCAAGTCCTGAGCATGGGCCA |
| Internal bar code: | GGCGGCATATCGCTGGCGTCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1131 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTAGATGAGGCGGTGATGG |
| Suggested primer 2: | TTACTCCTCCATGGCTCCGA |