Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.073393 |
Chromosome: | chromosome 2 |
Location: | 5709659 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g116300 | (1 of 1) K15171 - transcription elongation factor SPT4 (SUPT4H1, SPT4) | outside_mRNA | |
Cre02.g116350 | (1 of 5) PF03992 - Antibiotic biosynthesis monooxygenase (ABM) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTCGCACCTTTACCCCCCTCCGCCAGGCCACACGCCCCTGCTGCCACAA |
Internal bar code: | TTAAAGATTAAGCGTCACACAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 715 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 23 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGAATTTGTTGGGCGCAACT |
Suggested primer 2: | GAGAAGGTGCTTGGGGAGAC |