| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.073466 |
| Chromosome: | plastome |
| Location: | 26800 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802276 | ChreCp014,2717057,rpl16 | (1 of 1) PTHR12220//PTHR12220:SF14 - 50S/60S RIBOSOMAL PROTEIN L16 // SUBFAMILY NOT NAMED; 50S ribosomal protein L16 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTTTTCCTCTTAAATGACCACGGTGTGGTTTACGGAATTTTGTTCTTT |
| Internal bar code: | CTCTATGCCTTCCCGTTACAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 274 |
| LEAP-Seq percent confirming: | 34.2466 |
| LEAP-Seq n confirming: | 25 |
| LEAP-Seq n nonconfirming: | 48 |
| LEAP-Seq n unique pos: | 73 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATGAACGCTGCCAAAGGAG |
| Suggested primer 2: | AGGGCAGCCTTGATGAGAAA |