Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.073537 |
Chromosome: | chromosome 12 |
Location: | 5181231 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g527000 | CDPK14 | (1 of 1) PF07714//PF13202//PF13833 - Protein tyrosine kinase (Pkinase_Tyr) // EF hand (EF-hand_5) // EF-hand domain pair (EF-hand_8); Calcium/calmodulin-dependent protein kinase | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACGCGTGCGAGGAGAGTTCTTACGTTCAGGTGGGCCCAGTGGGCCGAGA |
Internal bar code: | GGAGTATAATTATGGACTGGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 478 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 6 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAATGGTCAGAGGTCAGGCG |
Suggested primer 2: | CTCAAACACGTCCTCCAGCT |