Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.073560 |
Chromosome: | plastome |
Location: | 187617 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
CreCp.g802331 | 2716963,ChreCp066,psbC | (1 of 1) K02705 - photosystem II CP43 chlorophyll apoprotein (psbC); photosystem II 43 kDa protein | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATAAATGTGCCAAATACCACCAAGGATTTCTAAAGTACCGATCCAAATG |
Internal bar code: | ATGCGCATACGTGATTTTGCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 239 |
LEAP-Seq percent confirming: | 33.3333 |
LEAP-Seq n confirming: | 9 |
LEAP-Seq n nonconfirming: | 18 |
LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGCCGTGACCAAGAAACAAC |
Suggested primer 2: | TTTTCGAAACCAGCAGCAGC |