Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.073561 |
Chromosome: | chromosome 13 |
Location: | 5106304 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g606850 | (1 of 1) K14548 - U3 small nucleolar RNA-associated protein 4 (UTP4, CIRH1A) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCGACTCCTCTTAACGAGCGCTGTCACACTGTGCCACCGGTGGTCCAGC |
Internal bar code: | TACTCGGTTGAGGCTAAATTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 992 |
LEAP-Seq percent confirming: | 96.875 |
LEAP-Seq n confirming: | 31 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATGGGAAGGGAATGTGCTGG |
Suggested primer 2: | CCGTTGCATTACGCTAGTGC |