| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.073591 |
| Chromosome: | chromosome 3 |
| Location: | 5279037 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g182500 | SRP72 | (1 of 1) K03108 - signal recognition particle subunit SRP72 (SRP72); Subunit of the Signal Recognition Particle | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACGGCATGCGCATCCCTCCTCCGGGGGGCGCTGTCCCACATCGGACCG |
| Internal bar code: | TGTGAAATCTTGGAATGAAGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1294 |
| LEAP-Seq percent confirming: | 37.1429 |
| LEAP-Seq n confirming: | 13 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTGTTTCAAGAGGGGTCGA |
| Suggested primer 2: | ATGACGCCACCCAGAAGAAG |