Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.073614 |
Chromosome: | chromosome 2 |
Location: | 6967878 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g389319 | (1 of 2) PTHR11266:SF17 - PROTEIN MPV17 | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTCCGCCAGCGTGACCAGCGGTGTGTGCGCCGAAGGCGCTGGCAAACAC |
Internal bar code: | ATGGATGCACCTCTCTCTACTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3117 |
LEAP-Seq percent confirming: | 42.2764 |
LEAP-Seq n confirming: | 52 |
LEAP-Seq n nonconfirming: | 71 |
LEAP-Seq n unique pos: | 123 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCCGCCACGATTCTGGAAAA |
Suggested primer 2: | GCGGACACACATAAGAACGC |