| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.073617 |
| Chromosome: | chromosome 9 |
| Location: | 3266262 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g394954 | (1 of 1) K03975 - membrane-associated protein (dedA) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGACCTCGCAGCGACGAGCTCGGCGCCCGCAGCCACCGCAACCCCATCC |
| Internal bar code: | GTTTGATGAAAATAGGAAGTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 442 |
| LEAP-Seq percent confirming: | 24.1379 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCCGCAAACACAATCGCAA |
| Suggested primer 2: | GCATGCAAGCACCAAAAGGA |