| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.073638 |
| Chromosome: | chromosome 12 |
| Location: | 4492691 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g520550 | TRN1 | (1 of 1) K18752 - transportin-1 (TNPO1); Importin beta | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCTACCCACAGTTAGTGTGGCTGGCTTTGCTCAACCGTTCATCAGGACA |
| Internal bar code: | ATTGGTAAGAAGTAGCATTTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3875 |
| LEAP-Seq percent confirming: | 69.4444 |
| LEAP-Seq n confirming: | 25 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGGATGGAGCTTGGTTGCA |
| Suggested primer 2: | CGCCATCACCATGCTGATTG |