| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.073646 |
| Chromosome: | chromosome 15 |
| Location: | 1216215 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g801719 | NCL59 | Nuclear Control of chloroplast-Like 59; (1 of 5) IPR013584//IPR016024 - RAP domain // Armadillo-type fold | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGATGCTGGAGCACTAGTATACCTACTGCCTAAGTCATGTCCACTCGCTG |
| Internal bar code: | CGACGTCTTTTAGGAAGTGTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2705 |
| LEAP-Seq percent confirming: | 16.6667 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 55 |
| LEAP-Seq n unique pos: | 66 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAATACGAGGTGCAGCATG |
| Suggested primer 2: | GTTGTTGGCGTTGTCAGTCC |