| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.073669 |
| Chromosome: | chromosome 12 |
| Location: | 2680921 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g505200 | HEL51 | (1 of 1) K14777 - ATP-dependent RNA helicase DDX47/RRP3 [EC:3.6.4.13] (DDX47, RRP3); DEAD/DEAH box helicase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGGCCCAATCCTGCCATCCGTGCCTGCCATCCGCAGCCATCCCTCTGCG |
| Internal bar code: | GCTAGCAAGGTGGGAAATCTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 193 |
| LEAP-Seq percent confirming: | 1.88679 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 52 |
| LEAP-Seq n unique pos: | 53 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCATTTGTTTGCGGTCCCTT |
| Suggested primer 2: | GGAATACATCCGTGCTCCGT |