| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.073704 |
| Chromosome: | chromosome 9 |
| Location: | 5145910 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g406550 | MOT31,RPP40 | (1 of 1) K14530 - ribonucleases P/MRP protein subunit RPP40 (RPP40); Ribonuclease MRP 40kDa subunit | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCACCACCCCCCACCCCACACACACACCCATACCCCCCACACACGCACA |
| Internal bar code: | AGCATTTCCGTTGGCAACGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 44 |
| LEAP-Seq percent confirming: | 5.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGGTAGGGCAGGGTAGAGT |
| Suggested primer 2: | CGGTAATGGGGTGGCTTTCT |