Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.073727 |
Chromosome: | chromosome 2 |
Location: | 2911476 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g095050 | (1 of 77) IPR012340 - Nucleic acid-binding, OB-fold | 3'UTR | |
Cre02.g095100 | CPLD26,PPO2 | (1 of 1) PTHR10851//PTHR10851:SF3 - PYRIDOXINE-5-PHOSPHATE OXIDASE // SUBFAMILY NOT NAMED; conserved expressed protein related to pyridoxamine 5' phosphate oxidase | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATGTGTGCAAATACTCAGTACTAATTATAACCCGACGTGACAATTTGCG |
Internal bar code: | CTAGGAATCCGTGTGAATTAGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3016 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 45 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 45 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCCATGCATCCACGGTATA |
Suggested primer 2: | CGGTCAGCTTCTGGAAAGGT |