| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.073752 |
| Chromosome: | chromosome 1 |
| Location: | 2731302 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g016528 | (1 of 1) 4.2.1.109 - Methylthioribulose 1-phosphate dehydratase / 1-PMT-ribulose dehydratase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCACCTTCATCCACCCTGCCCTGCCGTTGCAAATTGTTTGCCATCTTTT |
| Internal bar code: | ATAATGGGCGTTGCCTACGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 837 |
| LEAP-Seq percent confirming: | 92.3077 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCCCTCCATTTCTGTTCCC |
| Suggested primer 2: | CGCACGGATTGAGCTCAATG |