| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.073778 |
| Chromosome: | chromosome 1 |
| Location: | 8066983 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g062902 | (1 of 1) K15148 - mediator of RNA polymerase II transcription subunit 7 (MED7) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCCCCCCCCCCCCTCATTTGGTAACGACTTCATCTGCAGTCTTCGGTG |
| Internal bar code: | AATCCAAGGGGAAGCACAGATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1068 |
| LEAP-Seq percent confirming: | 21.1538 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 41 |
| LEAP-Seq n unique pos: | 52 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGCTTCATCATGAGGCTTG |
| Suggested primer 2: | CCTATTCCCCCTTCCTCCCA |