| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.073780 |
| Chromosome: | chromosome 12 |
| Location: | 9728876 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g553678 | (1 of 3) PTHR17130:SF24 - GAN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAACACGCCTCCCGCCACCGCGGCCCCTGCACCCAATCCCCCAAGCCCCG |
| Internal bar code: | TAAAGACCCTTTGGTGCAGTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 67 |
| LEAP-Seq percent confirming: | 4.54545 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGCGCTAACACCCTCAACA |
| Suggested primer 2: | CCTGGGGTGTGCATATGTGT |