| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.073783 |
| Chromosome: | chromosome 13 |
| Location: | 2639058 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g581150 | NAT30 | (1 of 36) PF00583 - Acetyltransferase (GNAT) family (Acetyltransf_1); N-acetyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCACAGTTGCGCCCCTTCAACAAACACACGGCGTCAAACCTCGCGCGGA |
| Internal bar code: | ATCTAGCATTAAAGACAATCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 249 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCCCACTTCCCTAGCTAGT |
| Suggested primer 2: | GACTCTGGAGCGTGTGTTGA |