| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.073791 |
| Chromosome: | chromosome 14 |
| Location: | 4085161 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g633650 | PRP6 | (1 of 1) PTHR11246:SF1 - PRE-MRNA-PROCESSING FACTOR 6; Splicing factor, component of the U4/U6-U5 snRNP complex | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCAGCCAGATGGCCTCGCTGCAAGAAGGTTAGGGGGGGATGGGTGTAGG |
| Internal bar code: | ATTATCTTCATTCACCAATTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 227 |
| LEAP-Seq percent confirming: | 78.9474 |
| LEAP-Seq n confirming: | 30 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGCGTTTTGAAGAGTGGTG |
| Suggested primer 2: | GAACTTCTCAAAGGCGGGGA |