| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.073808 |
| Chromosome: | chromosome 13 |
| Location: | 1100499 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g569200 | SRP54 | (1 of 1) PTHR11564//PTHR11564:SF5 - GTPASE CONTAINING FAMILY OF SIGNAL RECOGNITION PARTICLE PROTEINS // SIGNAL RECOGNITION PARTICLE 54 KDA PROTEIN; 54kDa Subunit of the Signal Recognition Particle | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTTCCTCACCTGCCCGCCCTCCTCCCCTCTCCTCCCCTCCCCTCCCCT |
| Internal bar code: | TGGGTGTATCCCATACGTATTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 461 |
| LEAP-Seq percent confirming: | 95.0 |
| LEAP-Seq n confirming: | 19 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAGGAAGAGAGGTCGATCG |
| Suggested primer 2: | CCGGCGATACATCACCATCA |