| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.073814 |
| Chromosome: | chromosome 6 |
| Location: | 4787134 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g279700 | (1 of 1) PTHR15535:SF22 - PROTEIN RLIB | 3'UTR | |
| Cre06.g279750 | MAP1A | (1 of 1) PTHR10804//PTHR10804:SF13 - PROTEASE FAMILY M24 METHIONYL AMINOPEPTIDASE, AMINOPEPTIDASE P // METHIONINE AMINOPEPTIDASE 1; Methionine aminopeptidase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTATAGAAGACGTGCATAATCGACAGCCCCATTTGGGGCCGCCATAAGGG |
| Internal bar code: | CTATACCAGGCCCTGTATTGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5329 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 133 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 133 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTCCTCAGGTTCCAGGTGG |
| Suggested primer 2: | CCCACCACGTATGATACCGG |