Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.073876 |
Chromosome: | plastome |
Location: | 129448 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
CreCp.g802318 | ChreCp054,2716983,atpF | ATP synthase CF0 B subunit; (1 of 1) PTHR34264:SF3 - ATP SYNTHASE SUBUNIT B, CHLOROPLASTIC | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAAAAACGCTCAGTTTTTATTTACTTACTTTCGAAGTTGCAAAGGAGTGA |
Internal bar code: | AGCTTTTCCAAAACTTGGAACT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 73 |
LEAP-Seq percent confirming: | 10.0 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGTAGTACCGCCACTGCCTA |
Suggested primer 2: | ACTGCCTTTGGTGCTTCCTT |