| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.073892 |
| Chromosome: | chromosome 6 |
| Location: | 8239455 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g306601 | ANS1 | Anthranilate synthase, alpha subunit; (1 of 1) 2.1.1.148 - Thymidylate synthase (FAD) / Flavin dependent thymidylate synthase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGTGGAGAGGGTGCGAGGTGGAGAGGGTGAGAGGGGGGCTGCTGGGGT |
| Internal bar code: | AGGGAGGATGCACGGGTGGACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 369 |
| LEAP-Seq percent confirming: | 86.6667 |
| LEAP-Seq n confirming: | 26 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTAGCATGGGAGATGAGGGC |
| Suggested primer 2: | GGTTGACAGGTTGAAACGCC |