| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.073937 |
| Chromosome: | plastome |
| Location: | 21165 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802272 | rpl36,2717053,secX,ChreCp010 | (1 of 2) PF00444 - Ribosomal protein L36 (Ribosomal_L36); 50S ribosomal protein L36 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAGGACGCTATTATTTACCAAAACAGGAAAAAGAATAGATTAGCTAATA |
| Internal bar code: | GTTGTTGACGAGGTTGGCGAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 236 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTTTGTGGTGGCTTTGCTG |
| Suggested primer 2: | GGTACCGCCACTGCCTATTT |