Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.073979 |
Chromosome: | plastome |
Location: | 101822 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
CreCp.g802308 | ChreCp044,2716995,psbL | photosystem II reaction center subunit XII; (1 of 1) K02713 - photosystem II PsbL protein (psbL) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTGTAATCAATTTTCTTGCCCAAAAGCTGCAGGCAGTTCTAAAAAAGTC |
Internal bar code: | GGTGTTTCAATTCGACGTTGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 178 |
LEAP-Seq percent confirming: | 9.00901 |
LEAP-Seq n confirming: | 10 |
LEAP-Seq n nonconfirming: | 101 |
LEAP-Seq n unique pos: | 111 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGGCTGTGGCTGTAGATAT |
Suggested primer 2: | TTACTTAGGACGGCAGTGGC |