Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.073991 |
Chromosome: | chromosome 12 |
Location: | 3230227 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g499700 | MFT3,MAE3 | (1 of 11) K03327 - multidrug resistance protein, MATE family (TC.MATE, SLC47A, norM, mdtK, dinF); MATE efflux family protein | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCACTGTACGGCTATGTGGGTCGAGTGATGTGCTGAATGTGACCACGAG |
Internal bar code: | TACGGTCAAATCCCTATAAACG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2666 |
LEAP-Seq percent confirming: | 85.4167 |
LEAP-Seq n confirming: | 41 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 48 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATTCCACCCAGGCTTCCATG |
Suggested primer 2: | CTAACACTGACGCGCATGTG |