| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.073996 |
| Chromosome: | chromosome 12 |
| Location: | 5444939 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g529651 | RPL7A | (1 of 1) K02936 - large subunit ribosomal protein L7Ae (RP-L7Ae, RPL7A); Cytosolic 80S ribosomal protein L7a | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCATGCTGTGCTCCCGTTCCCACGCCCAGATTCCGCTGCTTTTCTGCTT |
| Internal bar code: | GCATTTACACGTACTAATTATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 437 |
| LEAP-Seq percent confirming: | 24.1379 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAAGTACGGCCTGAACCAC |
| Suggested primer 2: | GGGGGTGAGCGAGTATGATG |