| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.074001 |
| Chromosome: | chromosome 2 |
| Location: | 3939838 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g102100 | SMM5 | (1 of 2) PF13679 - Methyltransferase domain (Methyltransf_32); S-adenosyl-L-methionine-dependent methyltransferase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCTTTTGGAGGAAGGGGTGCGGCCGGTCCGCAGGGATGGGCGTGGCCTT |
| Internal bar code: | AGGGATTGTTGCTACTGCTTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 988 |
| LEAP-Seq percent confirming: | 47.8261 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGGGAGGGTTCATGCCTTT |
| Suggested primer 2: | AAGTAGTGGTACGTGCCTGC |