Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.074007 |
Chromosome: | chromosome 4 |
Location: | 105138 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g216600 | RPT6 | (1 of 1) K03066 - 26S proteasome regulatory subunit T6 (PSMC5, RPT6); 26S proteasome regulatory subunit | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCGCTTTCAAGTCGCGGGCCGTGGTCGGTGCCGTACATGTTGGCGTAC |
Internal bar code: | AGTGGGGGCGTTTCTGTATGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 972 |
LEAP-Seq percent confirming: | 12.766 |
LEAP-Seq n confirming: | 6 |
LEAP-Seq n nonconfirming: | 41 |
LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATGTGTATGTGTCCAGCGCA |
Suggested primer 2: | ATCGAACCCAATGCAGCAGA |