| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.074015 |
| Chromosome: | chromosome 4 |
| Location: | 1541479 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g213652 | TERT1,TERT,CrTERT | Telomerase reverse transcriptase; (1 of 1) K11126 - telomerase reverse transcriptase (TERT, EST2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAAGGTGTGCATGGTTTTAGGCGCATCCCTGCCTCTCCCTATCCTCCACT |
| Internal bar code: | CCCAGATCCGCGATTCTAAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1670 |
| LEAP-Seq percent confirming: | 66.6667 |
| LEAP-Seq n confirming: | 28 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 42 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAAACGCTTCATCAGGCAA |
| Suggested primer 2: | AGGCCTGGAAGATGTTGAGC |