Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.074026 |
Chromosome: | chromosome 13 |
Location: | 2782861 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g582476 | (1 of 1) K01112 - phosphohistidine phosphatase (PHPT1) | 3'UTR | |
Cre13.g801538 | (1 of 73) IPR000477//IPR005135 - Reverse transcriptase domain // Endonuclease/exonuclease/phosphatase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTGCATGAACTGTTTTTCTTTTTGAATAATCCTTTTGAGACTAGTTTTG |
Internal bar code: | TATGCGGGGACCAAGAGTTCCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 786 |
LEAP-Seq percent confirming: | 60.8696 |
LEAP-Seq n confirming: | 14 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTTGACTCCGGAGCAAGTGA |
Suggested primer 2: | ATCGAGCACTAGAGCATGGC |