Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.074035 |
Chromosome: | chromosome 13 |
Location: | 4984375 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g801583 | (1 of 2) PF00665//PF07727//PF13976//PF14223 - Integrase core domain (rve) // Reverse transcriptase (RNA-dependent DNA polymerase) (RVT_2) // GAG-pre-integrase domain (gag_pre-integrs) // gag-polypeptide of LTR copia-type (UBN2) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTGGTGCAGCGATAGGCCGCGCGCGGCGGCGATGGCCAGAATGGCCCGC |
Internal bar code: | GTGAAATGAATTAAAGTTAGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2663 |
LEAP-Seq percent confirming: | 25.0 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATGAGGACAGCGACGATGAC |
Suggested primer 2: | CCCGCTTAATCTCCATCCCC |